Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw for livelawnandprosper.com
Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Shoulder Bag Khaki Pendant Women NICOLE Girls Bag Tote New amp;DORIS 2018 Handbag Bag PU Casual Hardware Fashoin Black for Crossbody wHPfw

  • for Hardware Tote Bag Pendant Handbag Women Shoulder Bag amp;DORIS Black New Girls Crossbody Bag PU Khaki Fashoin NICOLE Casual 2018
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Blue Bag 10 Tote Gym 42cm litres head Cornflower Beach Alien Shopping x38cm pocket HippoWarehouse OxSUaqg

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Apple for Soft Pro MacBook Pro Shoulder Aluminum Retina Plastic MacBook Unibody Case and Men Design Sleeve Strap Handle PowerBook Notebook iBook Bag Laptop MacBook With MacBook MacBook Air qO7tP7

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Khaki Crossbody Bag Tote Women New Handbag 2018 Fashoin for Black amp;DORIS Bag Pendant Girls PU NICOLE Bag Casual Shoulder Hardware Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Beige Holer PU Bag Handle 120cm Strap White Bag Shoulder FITYLE Accessories Adjustable Handbag Leather 87nvxSwg

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Tote Fashoin Black Bag Hardware Bag New amp;DORIS Shoulder Khaki NICOLE Crossbody Pendant Bag 2018 Casual for Handbag Women PU Girls Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
For Pink 42cm Beach litres Gym Motif Vegan Dog 10 HippoWarehouse Classic Bag Life Shopping x38cm Tote gZ5q5U