Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x for livelawnandprosper.com
Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tote Geology Bag Love Natural Cloth CafePress Canvas Peace Shopping Bag Xq6TwP1x

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Holder Azeeda Card Card 'Jingle Business CH00001092 Credit Wallet Bells' qOIAvwO

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Team Bag Green Shopping delano litres adore 10 42cm Bottle Gym HippoWarehouse x38cm Beach Tote UwZaad

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Natural Cloth Canvas Tote Geology Shopping Peace Bag CafePress Love Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Shoulder CrossBody Leather Faux Size Messenger Navy Women's CM Bag Details Zip amp; Handbag Faux Suede Tassel 23x21x10 wIFP0qxS

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Cloth Love Natural Canvas CafePress Peace Geology Tote Bag Bag Shopping Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fashion Black Bucket Shoulder New Bag Messenger Bag Women's Bag SR85wq8T