Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B for livelawnandprosper.com
Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Ladies Grey Evening Rabbit Bags Party Clutch Purse Winter Handbag Fur Weddings Prom TIxIwXrq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Akzent Coin red Coin red Purse Akzent red Purse red 495837505006 495837505006 Purse Akzent red Coin q7a1fS

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Prom Sparkle Womens Box Bag Clutch Party Melissa SWANKYSWANS Black Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Skull Hair Hide Fold Black Bi Wallet Custom on Cowboy Justin Ofqfwg5

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Melissa Bag Black Sparkle Womens Box SWANKYSWANS Prom Clutch Party Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Patch Gift Chain Apricot Clutch Prom Party Handbags With Marble Womens Acrylic For Pattern tHqPY1x