Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x for livelawnandprosper.com
Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x

  • Shoulder Bag BagsWomen Ladies Bags Leather Women Handbags Tote Handbag Stripe
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Clutch Linen Blue Light Bag Party Body Cross Snakeskin VP Prom Bag Shoulder Leather Galaxy SN10 Women Ladies aRnqwARrgY


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Man Retro Bag Of Gymnastics Red Black Floor Flight Evolution wCpTq5

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Shoulder Handbag Women Ladies Tote Bag Bags Handbags BagsWomen Stripe Leather Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blue Creek Blue Blue Creek Eagle Backpack Blue Eagle Smokey XTA Backpack XTA Smokey HwqZf700

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your BagsWomen Women Stripe Handbag Bags Shoulder Ladies Leather Handbags Bag Tote Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Men Bifold Wallet Protector for Credit RFID Leather Brown Card Excellent Wallet Brown Travel Artmi xqIf80H