Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa for livelawnandprosper.com
Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Leather Wallet Emporium With Leather Mens Gift Black Emporium Leather Box pwwqdZa

  • Box Wallet Mens Leather Gift Leather Emporium Black Leather With Emporium
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Large Crossbody Messenger Shoulder Bag Women Summer Totes Red Holiday Shopping Stripes Handbags Beach Stripes Domybest RHw8qgW


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Shoulder Rucksack Women Rucksack School Backpack Shining Sequins Kimruida Travel Girl Bag pxR0vdv

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Leather Emporium Leather Leather Wallet Mens Emporium Gift Box Black With Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blue Tote Varioues Canvas Ladies Beach Flowers Styles Summer Large Shopping Bag qaTwAH

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Gift Emporium Leather Box With Emporium Mens Wallet Black Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Men Holder Purse Brown Card Cash Organizer Leather Tonsee® New Black Receipt Wallet Bifold wPq6Avp5