Holding Clutch Hand Mini Iron Party Evening Personality Hexagon Black TuTu Geometric Bag Evening Irregular Box Bag wUYf7qPTx for livelawnandprosper.com
Holding Clutch Hand Mini Iron Party Evening Personality Hexagon Black TuTu Geometric Bag Evening Irregular Box Bag wUYf7qPTx Holding Clutch Hand Mini Iron Party Evening Personality Hexagon Black TuTu Geometric Bag Evening Irregular Box Bag wUYf7qPTx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Holding Clutch Hand Mini Iron Party Evening Personality Hexagon Black TuTu Geometric Bag Evening Irregular Box Bag wUYf7qPTx

  • Black Geometric Irregular Hexagon Party Mini Bag Evening Holding Hand TuTu Iron Personality Box Clutch Evening Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Handbag Pure Bag Bags Color Shoulder Square Lock Bag Small Shoulder Bag Lady'S Bag Women'S TRqwqZx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Silver Wedding Damara Glitter Clutch Party Womens Crystal Pleated Stylish XqX8F

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • TuTu Hand Hexagon Evening Geometric Evening Box Party Bag Mini Black Personality Clutch Iron Holding Irregular Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

FOR CREDIT CARD HOLDER MONTBLANC BMW Red MONTBLANC FOR IzqEX

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Hand Geometric Box Party Irregular Clutch Bag Mini Evening Hexagon Iron Holding Evening TuTu Bag Black Personality Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
10 HippoWarehouse 42cm Black Viola Keep the Calm x38cm Play Gym Tote and Beach Shopping Bag litres rqOXrZP