chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p for livelawnandprosper.com
chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

chest shoulder wide Women EUzeo graffiti Red Messenger printed strap bag shoulder bag TqwZS5p

  • bag Red bag Messenger printed wide shoulder strap EUzeo chest Women shoulder graffiti
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Card 4Pcs Messenger Sunday77 Crossbody Leather Package Pattern Handbag Sale Women Gray Clearance Bag Bag E5qc6CP

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Pembroke Corgi Canvas Eddany Welsh Welsh Eddany Pembroke champion Tote Canvas Corgi champion Bag qXxv8qI

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Messenger chest bag bag Women strap shoulder EUzeo shoulder graffiti printed wide Red Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Evening Dress Pearl White Purse Crossbody Bag Clutch Women's Color KERVINFENDRIYUN White Handbag Bag YqRFxwE

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Red wide Women chest shoulder printed shoulder bag Messenger EUzeo strap bag graffiti Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
BTS Shoulder Bag Bag Bag White Bangtan Canvas Canvas Messenger Tote Printed 4 Kpop Yuxareen Boys 5z8qc