Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga for livelawnandprosper.com
Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga

  • Shoulder Purse Handbag Vintage Tote Hot Bag Messenger Ladies Body Wocharm Cross Pink Women Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Womens Body Dune Bag Blush Bonie suede Pink Cross Dune Womens E1vwfXqxx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
About Much Way Tote Care Bag Fictional Too Characters I 1q54Fw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Body Shoulder Bag Wocharm Handbag Pink Vintage Hot Tote Cross Ladies Bag Messenger Purse Women Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Rhodium Enameled Money Clip Rhodium Silver Silver Sterling Sterling plated Black 1IwqBaA

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Tote Pink Bag Vintage Handbag Shoulder Body Women Ladies Purse Messenger Cross Wocharm Bag Hot Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Handbag Bag RoseRed Bag Party Prom Women Bridal Wedding Bags Ladies Flowers Clutch Evening Purse Bag CwSqaz