Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B for
Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Melissa Party SWANKYSWANS Box Clutch Bag Prom Sparkle Black Womens qTWn7B


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Credit Card Wallet 'Rock Holder Card CH00015044 Business Climber' Azeeda nRPAqpOA


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Temporary Natural HERME for Men Women Hairstyle Hairstyle Wax Cream 1pcs and U5xq1wHR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Black Melissa Box SWANKYSWANS Party Sparkle Clutch Prom Womens Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Holder Credit Card Card 'Christmas Wallet Tree' CH00002527 Azeeda Business wxg6aOU

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Party Prom Black Clutch Sparkle Womens SWANKYSWANS Box Bag Melissa Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
HandBags Bag Velvet Girly Sequins Clutch Girly Red HandBags 8qxUzw8B