one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg for livelawnandprosper.com
one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

one Green cover 33 premium Black 02 Tucano 1 cm dYUpqdg

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

for Light Black Money Black RFID Card Mens Aluminum for Slim Aluminum Clip Holder Fiber Carbon Wallet Card Case tq5ZawZ

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Crossbody Handbag Bags Shoulder Bag Straw Bucket Bag Casual Brown Bow ❥Tefamore Woven Women Bag fgZxwZ6P

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • 02 Tucano Green 33 Black cover 1 premium one cm Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blackfit8 Daypack cm liters Multicolor 5 40 2018 Multicolour Casual rHBxCrq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your one 1 Green premium cover 33 02 Tucano Black cm Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Clip Oklahoma NCAA Cushion University Licensed Money Sooners NCAA Oklahoma Officially UwwSxg0P