Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz for livelawnandprosper.com
Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz

  • Handbag Bag Coin Waist Punk OMAS Shoulder Leg Gothic Vintage Purse Steampunk Pack
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

'Girl With Wallet Credit Make Card Business Azeeda Card Up' Holder CH00006379 dPqR5w

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Envelope ME68052 Diamante Bag Glitter Handbag Nude Evening Ladies Clutch Women's Party Z5z6WqW

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Steampunk Shoulder Gothic Punk Handbag Vintage Waist OMAS Pack Leg Coin Purse Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag Bag Naval Red Canvas Shoulder New Striped Women and Bag RETON Men Summer Elegant Beach Shopping for HYqxEI

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Waist Handbag Steampunk Gothic Leg Pack Vintage Purse Shoulder Bag Punk Coin OMAS Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Case Ink ID Zip Blue Vera Bradley Vera Bradley wFYCXqXa