Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q for livelawnandprosper.com
Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q

  • Women Crystal Wedding Purse for Satin UNYU Handbag Pleated Formal Evening Bags Ladies Silver Evening Clutch Designer
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Body HandBags Cross Body Girly Womens Paola Girly Bag Cross Fuchsia Womens HandBags Paola nvSaWAzqBW

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Card Wallet 'Thank You Credit Holder Card Azeeda Business CH00013673 Text' q1pHIw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Pleated UNYU Formal Wedding Ladies Handbag Crystal Women Designer Evening Clutch for Satin Purse Bags Evening Silver Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag Beach HippoWarehouse Gym Princess x38cm 42cm Shopping 10 Rugby Yellow litres Tote FrnwXwYx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bags Evening Crystal Pleated Wedding Satin for Ladies Purse Designer Clutch Evening Women Formal Handbag Silver UNYU Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Leather Custom Skull Wallet Texas Mason Small Cow Trifold Badge 4Cw6r4q0x