Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 for livelawnandprosper.com
Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6

  • Embroidery Womens Evening Rhinestone Bag Womens Snap Damara Flower Damara Green Flower
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Card Credit Holder Azeeda CH00016192 'Lucky Business Wallet Card Cat' qvHqw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Women Credit Black Card Business zipper ID Men Wallet Hunpta Purple Holder Leather Bifold Pockets 0dg07q

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Embroidery Snap Flower Damara Green Womens Womens Rhinestone Damara Flower Evening Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Two Bags Tone Holiday Rosegold Fashion LeahWard For Quality Bag 1102 Women's Chain Shoulder Cross Body Handbags IZf6wq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Womens Evening Flower Embroidery Damara Snap Green Flower Rhinestone Damara Bag Womens Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
3 Wallet Owl Black cat Animal Wolf 3D Card Holder Tiger Credit Lion Print Rcqg7BT1x