Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw for livelawnandprosper.com
Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw

  • Fashion Grey 25X11X23CM LxWxH Handbag Bag Leather DISSA VQ0837 Women Casual Shoulder
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Hot Style Case Messenger for Kindle Amazon Orange Trim Black Tablet amp; Bag Carry UxwqXq5

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Woman Bag Shoulder Bag Single Square Grey Bag Mini Bag wTHxnRnqz

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Grey Bag LxWxH Women Leather VQ0837 DISSA Shoulder Handbag 25X11X23CM Fashion Casual Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Marco 61013 Baguette Marco Rose Pink Tozzi Women’s Tozzi 5WT464q

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Handbag Grey Women Shoulder Bag Casual DISSA LxWxH Fashion VQ0837 25X11X23CM Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Card Business Azeeda Holder Wallet Azeeda Card 'Star' CH00006689 'Star' Credit q0pFtw6