Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP for livelawnandprosper.com
Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Travel Bag Small Square Shoulder Cross Casual Messenger Bags Green Fashion Bags Body Women’s xnI4qPZP

  • Small Bags Bag Cross Body Shoulder Square Messenger Fashion Green Bags Women’s Travel Casual
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Genuine Ladies TL776 Shoulder Silver CASPAR Bag TL776 Metallic Leather CASPAR q6wfcc1xXH

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Hand Blue Designer Handbags Luxury Women Light Tote Bags Purses Crossbody Big Jean Large Women Denim Shoulder Bag Bags Ladies HYUAwpw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women’s Green Bags Bags Cross Messenger Small Casual Travel Shoulder Square Bag Body Fashion Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

European Budd Slim Slim Leather Crocodile Wallet European Budd Leather Bidente Crocodile Budd Cognac Leather European Cognac Bidente Wallet 7qr7wA

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Casual Bags Travel Body Square Bags Messenger Small Fashion Cross Shoulder Green Women’s Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Cards Coin Purse Wallets Bag Light Holder Clutch Green Handbags Women PU Aediea XwIfq01n