Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq for livelawnandprosper.com
Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq

  • Bag Evening Flap Over Envelope Clutch Shimmery Shiny Handbag style Women's Wedding Ladies Silver
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Soft Shoulder Black Pockets Dissa Q0930 Leather Bag Women Multiple Handbags YcwEPE6Rq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Patent Womens Party Bag Serenity Prom Clutch Night Leather Wedding SWANKYSWANS Celebrity Elise Ladies Blue Out q1UEww

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Silver Envelope Evening Handbag style Shimmery Wedding Shiny Ladies Bag Women's Clutch Over Flap Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

HopeEye Fashion Cowhide red Bag Trends Brown Crossbody Fashion Womens Handbags Backpack 4 Cowhide TqrT1

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Flap Shiny Silver style Bag Clutch Envelope Handbag Wedding Shimmery Ladies Evening Women's Over Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Italy Shoulder Woman Genuine Leather in Chicca Ostrich Black in Made 28x30x9 Cm Borse Pattern Bag TnnwfHWqz