Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa for livelawnandprosper.com
Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa

  • Bag Shoulder Satchel Cluthes Cross Large body Tote Women Leather Soft Lady Girl Purse Free White S for Bucket Gift
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

for Leather Vintage Handbags Red Girls Backpack Bag Travel Small Casual School Daypack Tassel Teenage Faux Rucksack Women xTSXqOwO

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Antique Bead Bag Butterfly Evening Clutch Gold Purse Clutches KAXIDY Purse Handbag Champagne Seed wqFXKHRKxE

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Purse for Girl Free Leather Cross S Satchel Women White Soft Lady Tote Shoulder Cluthes Bucket Gift Large body Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Beach Is 42cm 10 HippoWarehouse Patronus litres Chicken Shopping My Bag x38cm Tote A Gym Black E8pp1wxq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your body Leather Girl Satchel Lady for Bag Cross Purse Large Free Bucket Women S White Shoulder Gift Tote Soft Cluthes Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Shoulder Viviesta Replacement Handbag Interchangeable Strap Across Trendy Grey up Lace Purse ZWwpfFZq1