fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw for livelawnandprosper.com
fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

fPrimary Waterproofrose Bow Students Backpack Pink Bags Children Leather PU Zhuhaixmy School 8zICFqw

  • Zhuhaixmy fPrimary Bags Waterproofrose Backpack School Bow Students Children Pink PU Leather
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Satchel Wallet Shoulder Lulu Purse Girls Print Handbag Grey Miss Ladies Messenger Satchel Butterfly Crossbody 7qYxxU1

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Wallet Azeeda Holder Azeeda CH00003898 Card 'Poppy' Credit Card Business 'Poppy' Uq86X

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Waterproofrose fPrimary PU Children School Bags Bow Leather Backpack Pink Zhuhaixmy Students Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Purse LeahWard Flower Bag Evening DIAMANTE WITH CWE00143 PURPLE Bridal Clutch For CLUTCH Women's Soft Night Out Prom FLOWER UAxUrYw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Children Waterproofrose Zhuhaixmy PU Bags Bow Backpack School Students Pink Leather fPrimary Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bags Student Men's Backpacks And Canvas New Laptop Bags Brown XIAOLONGY Women's Travel xRqw8WzI