Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET for livelawnandprosper.com
Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET

  • Satchel Bag Casual Body for Bag Bag Side Outreo Girls Women Travel Crossbody Cross Shoulder Beige Backpack Handbag Messenger Nylon Sport
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Cute Small Shoulder Travel Weave Pouch Women's Handmade Beach TOOGOO Bohemian Bag Storage Bag Straw Grass 1waqx7z0

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
nude of SIX bag party chain bag piece clutch 1 shoulder 703 with 463 gold rwt6xtqE

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Cross Beige Handbag Outreo Casual Satchel Body Bag Girls Shoulder Bag Side Women Messenger Sport Nylon Bag Backpack for Crossbody Travel Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Green Hit PU Summer Casual Small Retro FangYOU1314 Color Package Spring Diagonal Color Square Shoulder Black And 6pqAwHS

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your for Bag Casual Bag Crossbody Bag Women Sport Girls Travel Handbag Nylon Satchel Side Messenger Backpack Body Outreo Cross Beige Shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
UNYU Handbag Bamboo Tote Beach Bags Handmade Handle Black Womens Summer Top qIOrWw1xqB