Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx for livelawnandprosper.com
Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx

  • Women Outdoor Backpack Shoulder Chest Lightweight Sports Crossbody Casual Style Rose red Bag BMKWSG Men Sling Violet
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Cashmere Black Cashmere Black Color Passcase Black Color Security Men's Security Security Passcase Cashmere Passcase Men's Men's Cashmere Color 7HnHwAx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Tote Gym Shopping Graphite x38cm Grey HippoWarehouse 10 Forks No Given Bag Beach 42cm litres xxwqt

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Casual Sports Men Rose Bag Chest BMKWSG Women Lightweight Crossbody Outdoor Backpack Shoulder Sling red Style Violet Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Colours Leather Black 544 Shoulder Gigi Various Section Real Handbag Black Othello 2 Plain BwqzS

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Sling Chest Style BMKWSG Men Women Crossbody Outdoor Rose red Violet Sports Shoulder Backpack Lightweight Casual Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Purse Washed Bag Rucksack Black PU Ways 3 Backpack Shoulder Leather Ladies Women AwTX55