Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x for livelawnandprosper.com
Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x

  • Handbag BagsWomen Ladies Stripe Women Shoulder Tote Leather Handbags Bags Bag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Large Handbag And SJMMBB SJMMBB Big Bag Bag Capacity Brown Bag Cn8UY

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
for Galaxy Travel Youth Showudesigns Women Stylish color Handbag Cat Tote 2 Neoprene x4qSx6pn5

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Handbag BagsWomen Handbags Stripe Leather Tote Ladies Bag Shoulder Bags Women Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Leather Oliver Small Case Black Crafted Card Hand Leather Wallet qtrtTv

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your BagsWomen Bag Stripe Shoulder Women Handbag Tote Bags Ladies Handbags Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
shoulder Leather Pu Clutch Envelope Purse Women's Handbag Holographic Silver Meliya Laser Chain Bag qOtWS