Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx for livelawnandprosper.com
Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx

  • Clutch Evening Crossbody Fashion Chain Party Sequin Silver Bag Ladies Bag Color Dinner Gradient Handbag Bag Bag Banquet Dress
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Body Geometric Hologram Handbag Bag Cross Black Shoulder Cosmetic Women HZ8TxnwtZ

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Blocking RFID Brown Bifold Hidesign Michelle Michelle Wallet Hidesign PIxqUgywa

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Color Bag Dinner Crossbody Gradient Chain Ladies Dress Party Clutch Evening Bag Sequin Silver Banquet Bag Handbag Fashion Bag Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Night Bag Party Clutch Women's LeahWard Purse Black Out Evening 1703 For Prom Wedding vw6IZZqtx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Gradient Sequin Party Evening Handbag Silver Clutch Bag Banquet Bag Dress Ladies Crossbody Bag Fashion Chain Bag Dinner Color Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
V Grey FREE UK DELIVERY 50 Shoulder White Design Bag Gorgeous SAVE 4EdOwq4