Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw for livelawnandprosper.com
Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw

  • VQ0837 Handbag Casual DISSA 25X11X23CM Fashion Shoulder LxWxH Leather Women Bag Grey
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

RealSlickTees RealSlickTees Glamping Tote Bag Queen Queen Tote Bag Glamping Grey Grey WXHrwUXqp

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Casual Womens Tote A Bags Small Vintage Bags Leather Shoulder Square Soft Handbags xIXqIFT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather 25X11X23CM DISSA Shoulder VQ0837 Bag Handbag Grey LxWxH Casual Fashion Women Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

42 Mens Leather Designer By Mens Leather Black London Designer Wallet 7rFZwqx7n

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Casual Leather Handbag 25X11X23CM LxWxH Shoulder Fashion DISSA Women VQ0837 Grey Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Havana Eddany silhouette Bag Eddany Havana Brown Tote Brown Canvas UHtqnpw