Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 for livelawnandprosper.com
Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4

  • Party Evening Women Pink2 NOTAG Clutch Strap Bag With PU Casual Envelope Chain Clutches For Leather Handbag
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Mini GROSSARTIG Dress Luxury Black Fringe Lady Bag shaped Dinner Clutch Fashion Heart R5wr5SqC

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Shoulder Soft Dissa Handbags Pockets Q0967 Leather Bag Multiple Black Women EYBYH

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women PU Evening With Envelope Clutch Casual Party Handbag Chain For Bag Clutches NOTAG Strap Leather Pink2 Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

School Large Backpack Capacity Brown Moollyfox Backpack Students Bag Style Leopard Preppy Travel Women Print For Sq4anxwF0z

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Chain Evening Party Handbag NOTAG Leather With Clutches Clutch Casual PU Pink2 Bag Strap For Women Envelope Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Peace Shoulder Psychedelic Tote Psychedelic CND Green Tote Bag Peace Bag Symbol Symbol Shoulder CND TTAw8qaxP