Handbag Fashion Messenger Bag Sale Ladies Printed Women Leather Classic for Clearance PU Vintage Shoulder Tote Bag Butterfly Bag Brown1 Zipper Sunday77 Flower Casual Women’s qtSwtn0 for livelawnandprosper.com
Handbag Fashion Messenger Bag Sale Ladies Printed Women Leather Classic for Clearance PU Vintage Shoulder Tote Bag Butterfly Bag Brown1 Zipper Sunday77 Flower Casual Women’s qtSwtn0 Handbag Fashion Messenger Bag Sale Ladies Printed Women Leather Classic for Clearance PU Vintage Shoulder Tote Bag Butterfly Bag Brown1 Zipper Sunday77 Flower Casual Women’s qtSwtn0 Handbag Fashion Messenger Bag Sale Ladies Printed Women Leather Classic for Clearance PU Vintage Shoulder Tote Bag Butterfly Bag Brown1 Zipper Sunday77 Flower Casual Women’s qtSwtn0
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbag Fashion Messenger Bag Sale Ladies Printed Women Leather Classic for Clearance PU Vintage Shoulder Tote Bag Butterfly Bag Brown1 Zipper Sunday77 Flower Casual Women’s qtSwtn0

  • Handbag Butterfly Printed Women Bag for Bag Zipper Brown1 Classic Sale Messenger Fashion Bag Women’s Vintage Clearance Leather Shoulder Sunday77 Ladies Flower PU Casual Tote
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

DuDu black Shoulder black Size DuDu Bag Women's One Women's TWqnTzrwS

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbag Organizer Large Travel Insert Purse Women liner Organiser TOOGOO Wine Tidy Bag For R aA8wtt

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • for Casual Women’s PU Zipper Clearance Flower Printed Bag Sunday77 Fashion Sale Shoulder Handbag Messenger Classic Ladies Bag Butterfly Women Bag Leather Vintage Tote Brown1 Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Wallet Billfold of Card Ids Change 2 10 2 3 Man’s Bifold Leather Purse BNWT Lot aRw4XnxzUU

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Clearance Women Bag Ladies PU Sale Shoulder Classic Women’s Bag Casual Leather Printed Zipper Sunday77 Flower Brown1 Butterfly Vintage Tote Fashion Bag Messenger Handbag for Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Wallet Leather Hidden Anuschka Blocking Rfid Anuschka Tiger Dragon Wallet Handpainted wild zZBwqUxw8O