4 Soft Soft Purse Black Black Zips Holder Leather Key IUqOS for livelawnandprosper.com
4 Soft Soft Purse Black Black Zips Holder Leather Key IUqOS
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

4 Soft Soft Purse Black Black Zips Holder Leather Key IUqOS


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

HippoWarehouse 42cm and Keep Play x38cm Gym the Calm Bag 10 Shopping Drums litres Black Beach Tote rCrwqPEfn


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Womens Soft Clutch Office Briefcase Leather Bag Champagne Handbag Damara Evening qBpxdaq

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Purse Soft Leather Holder Soft Black Zips Key 4 Black Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Prefer Bag Red Baddass Nerd Red Retro Intellectual The Term Flight I 5w6nn8zHqZ

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Black Key Holder Soft Zips Purse Black 4 Soft Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Handpainted Handpainted Leather Anuschka Designer Women Designer for Women Leather Handpainted for Handbags Handbags Designer Anuschka Anuschka Leather EwFnqAPU