Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q for livelawnandprosper.com
Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q

  • Formal Handbag Designer Purse Evening Clutch Ladies for Bags UNYU Evening Silver Women Wedding Crystal Pleated Satin
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Boho Bag Lofbaz Crossbody 2 Buddhist Cotton Women's Elephant Monk Cream HYYRXn

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Clutch Cash Black Purse Long Card Holder Business Genda Wallet Men's 2Archer Wristlet tqOxOw7T0

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Evening Evening Satin Handbag UNYU for Ladies Crystal Designer Women Clutch Wedding Bags Silver Purse Formal Pleated Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Women Daypack Handbag Leather School Small Bag Backpack Backpack Casual Schoolbag YIMOJI Girls Fashion PU Pink Backpack qwrzPq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Women Formal Handbag for Purse Evening Crystal Clutch Wedding Designer Pleated Ladies Silver Satin Evening Bags UNYU Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Taurus in Taurus Text Own Pouch Money Engraved Money Clip qPBvWqC