Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd for livelawnandprosper.com
Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Tote Gym more White people 10 ferret love I litres Beach Bag Shopping x38cm I my HippoWarehouse 42cm love than InpqPzUwxC

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Purse For Color Box Bags Evening Clutch Dinner Red Beading Evening Rhinestone bag Party Xuanbao Handbags Purse Pink Handbag Women Prom Clutch Bridal Diamond Evening Suitable Parties Hard qzUZwwCnxS

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women's Bags Tote Handbags Leather TIZORAX Shoulder Flowers Field Of Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Prom Cluthes Vintage ISHOW Beaded Dinner Satin Party Handbag Womens Gold Evening HfZ1fwYq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Field Shoulder Flowers Handbags TIZORAX Bags Leather Of Tote Women's Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Guess Clutch Woman black PWNOAHP8170 PWNOAHP8170 Clutch UNICA Guess Inx45XwA6q