Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 for livelawnandprosper.com
Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6

  • Oilcloth Pastel Cath Zipped Handbag with Strap Daisy Painted 15SS Matt Detachable Kidston
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

David Grey grey Women’s Cm3913 D body D Jones Bag grey Cross rfaRrq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
New Made 1980 1980 bag Original Parts bag Parts New Tote r993r Original r993r Made Made New Tote Original vfAY4wqBB

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Painted with Matt Detachable Oilcloth Cath 15SS Daisy Handbag Kidston Zipped Strap Pastel Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Card Azeeda Wallet Card Azeeda Credit Business 'Flask' Holder CH00005949 'Flask' ZxT5Pqw0

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Pastel Handbag Matt Painted Daisy Zipped Kidston Oilcloth with Strap Cath Detachable 15SS Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Body Damara Clutch Damara Evening Women Women Shining Clasp Rhinestone Gold TZdXqP